(See the previous and initial iteration.)
Intro
This time, I decided to pack the genomic data such that 4 nucleotide bases are encoded into a single byte. In other words, A is mapped to binary 00, C to 01, G to 10, and T to 11. For example, the genomic string CATG will be encoded as 10110001.
Code
io.github.coderodde.dna.kmerindex.GenomicSequence.java:
package io.github.coderodde.dna.kmerindex; import java.util.Arrays; import java.util.Objects; /** * This class implements a tightly packed genomic sequence over the nucleotide * base alphabet <code>A, C, G, T</code>. Each byte, contains 4 nucleotide * bases. * * @version 2.0.0 (Aug 18, 2025) * @since 1.0.0 (Aug 17, 2025) */ public final class GenomicSequence { private static final int NUCLEOTIDES_PER_BYTE = 4; private static final int BITS_PER_CODE = 2; private final byte[] data; private final int length; public GenomicSequence(String sequence) { Objects.requireNonNull(sequence, "The input sequence is null"); data = new byte[sequence.length() / NUCLEOTIDES_PER_BYTE + (sequence.length() % NUCLEOTIDES_PER_BYTE != 0 ? 1 : 0)]; length = sequence.length(); for (int i = 0; i < sequence.length(); ++i) { char nucleotideBase = sequence.charAt(i); checkNucleotideBase(nucleotideBase); writeToData(nucleotideBase, i % NUCLEOTIDES_PER_BYTE, i / NUCLEOTIDES_PER_BYTE); } } public char get(int nucleotideIndex) { if (nucleotideIndex < 0) { throw new IndexOutOfBoundsException( String.format( "nucleotideIndex(%d) < 0", nucleotideIndex)); } if (nucleotideIndex >= length) { throw new IndexOutOfBoundsException( String.format( "nucleotideIndex(%d) >= length(%d)\n", nucleotideIndex, length)); } int byteIndex = nucleotideIndex / NUCLEOTIDES_PER_BYTE; nucleotideIndex %= NUCLEOTIDES_PER_BYTE; byte datum = data[byteIndex]; datum >>>= nucleotideIndex * BITS_PER_CODE; datum &= 0b11; switch (datum) { case 0b00 -> { return 'A'; } case 0b01 -> { return 'C'; } case 0b10 -> { return 'G'; } case 0b11 -> { return 'T'; } } throw new IllegalStateException("Should not get here"); } @Override public String toString() { StringBuilder sb = new StringBuilder(length); for (int i = 0; i < length; ++i) { sb.append(get(i)); } return sb.toString(); } /** * Extracts a kmer of length {@code k} starting from index * {@code startIndex}. * * @param k the length of the requested <code>k</code>-mer. * @param startIndex the starting index of the requested <code>k</code>-mer. * @return the requested <code>k</code>-mer. */ public GenomicSequence kmer(int k, int startIndex) { checkKmerParams(k, startIndex); StringBuilder sb = new StringBuilder(k); for (int i = 0; i < k; ++i) { sb.append(get(startIndex + i)); } return new GenomicSequence(sb.toString()); } @Override public int hashCode() { return Arrays.hashCode(data); } @Override public boolean equals(Object o) { if (o == null) { return false; } if (o == this) { return true; } if (!getClass().equals(o.getClass())) { return false; } GenomicSequence other = (GenomicSequence) o; if (other.length != length) { return false; } return Arrays.equals(data, other.data); } public int length() { return length; } private void checkKmerParams(int k, int startIndex) { if (k < 1) { String exceptionMessage = String.format( "The k-parameter is too small (%d). Must be at least 1", k); throw new IllegalArgumentException(exceptionMessage); } if (k > length) { String exceptionMessage = String.format("k(%d) > length(%d)", k, length); throw new IllegalArgumentException(exceptionMessage); } if (startIndex + k > length) { String exceptionMessage = String.format("startIndex(%d) + k(%d) = %d > length(%d)", startIndex, k, k + startIndex, length); throw new IllegalArgumentException(exceptionMessage); } } private static void checkNucleotideBase(char candidate) { switch (candidate) { case 'A', 'C', 'G', 'T' -> { return; } } String exceptionMessage = String.format( "Invalid nucleotide base: %d\n", candidate); throw new IllegalArgumentException(exceptionMessage); } private void writeToData(char nucleotideBase, int nucleotideIndex, int byteIndex) { int index = nucleotideIndex % NUCLEOTIDES_PER_BYTE; byte mask = encodeNucleotideName(nucleotideBase); mask <<= index * BITS_PER_CODE; data[byteIndex] |= mask; } private static byte encodeNucleotideName(char nucleotide) { switch (nucleotide) { case 'A' -> { return 0b00; } case 'C' -> { return 0b01; } case 'G' -> { return 0b10; } case 'T' -> { return 0b11; } } throw new IllegalStateException("Should not get here"); } } io.github.coderodde.dna.kmerindex.DnaKmerIndex.java:
package io.github.coderodde.dna.kmerindex; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Objects; /** * This class implements the <code>k</code>-mer index data structures that maps * each <code>k</code>-mer to the list of indices at which that very * <code>k</code>-mer appears. The alphabet is restricted to the set of * nucleotide bases <code>A, C, G, T</pre>. * * @version 2.0.0 (Aug 18, 2025) * @since 1.0.0 (Aug 17, 2025) */ public final class DnaKmerIndex { // Package-private since DnaKmerIndexToStringConverter uses this: final Map<GenomicSequence, List<Integer>> index = new HashMap<>(); public DnaKmerIndex(GenomicSequence sequence, int k) { checkArguments(sequence, k); for (int i = 0; i < sequence.length() - k + 1; ++i) { GenomicSequence kmer = sequence.kmer(k, i); if (!index.containsKey(kmer)) { index.put(kmer, new ArrayList<>()); } index.get(kmer).add(i); } } public List<Integer> getListOfStartingIndices(GenomicSequence kmer) { return !index.containsKey(kmer) ? List.of() : Collections.unmodifiableList(index.get(kmer)); } private void checkArguments(GenomicSequence sequence, int k) { Objects.requireNonNull(sequence, "The input GenomicSequence is null"); if (sequence.length() == 0) { throw new IllegalArgumentException("Empty sequence"); } if (k < 1) { String exceptionMessage = String.format( "The k-parameter is too small (%d). Must be at least 1", k); throw new IllegalArgumentException(exceptionMessage); } if (k > sequence.length()) { String exceptionMessage = String.format("k(%d) > sequence.length(%d)", k, sequence.length()); throw new IllegalArgumentException(exceptionMessage); } } } io.github.coderodde.dna.kmerindex.DnaKmerIndexToStringConverter.java:
package io.github.coderodde.dna.kmerindex; import java.util.Arrays; import java.util.List; import java.util.Map; import java.util.Objects; /** * This class is responsible for converting a * {@link io.github.coderodde.dna.kmerindex.DnaKmerIndex} to a neat string that * may be arbitrary or sorted. * * @version 1.1.0 (Aug 18, 2025) * @since 1.0.0 (Aug 17, 2025) */ public final class DnaKmerIndexToStringConverter { private boolean sorted = true; private final DnaKmerIndex index; public DnaKmerIndexToStringConverter(DnaKmerIndex index, boolean sorted) { this.index = Objects.requireNonNull(index, "The input index is null"); setSorted(sorted); } public DnaKmerIndexToStringConverter(DnaKmerIndex index) { this(index, true); } public void setSorted(boolean sorted) { this.sorted = sorted; } public boolean isSorted() { return sorted; } @Override public String toString() { StringBuilder sb = new StringBuilder(); for (Map.Entry<GenomicSequence, List<Integer>> e : index.index.entrySet()) { sb.append(e.getKey()) .append(" -> ") .append(e.getValue()) .append('\n'); } if (sb.length() > 0) { sb.setLength(sb.length() - 1); } if (sorted) { String[] lines = sb.toString().split("\n"); Arrays.sort(lines); return String.join("\n", lines); } return sb.toString(); } } io.github.coderodde.dna.kmerindex.RandomGenomicSequenceProvider.java:
package io.github.coderodde.dna.kmerindex; import java.util.Random; /** * This class provides a facility for computing a random genetic string. * * @version 1.0.0 (Aug 16, 2025) * @since 1.0.0 (Aug 16, 2025) */ public class RandomGenomicSequenceProvider { private static final char[] NUCLEOTIDE_BASES = { 'A', 'C', 'G', 'T' }; /** * Generates a random genomic string. * * @param length the length of the genomic string. * @param random the random number generator. * @return a random genomic string. */ public static String generate(int length, Random random) { StringBuilder sb = new StringBuilder(length); for (int i = 0; i < length; ++i) { int nucleotideIndex = random.nextInt(NUCLEOTIDE_BASES.length); sb.append(NUCLEOTIDE_BASES[nucleotideIndex]); } return sb.toString(); } /** * Generates a random genomic string. * * @param length the length of the genomic string. * @return a random genomic string. */ public static String generate(int length) { return generate(length, new Random()); } /** * Generates a random genomic string. * * @param length the length of the genomic string. * @param seed the seed for the random number generator. * @return a random genomic string. */ public static String generate(int length, long seed) { return generate(length, new Random(seed)); } } io.github.coderodde.dna.kmerindex.demo.Demo.java:
package io.github.coderodde.dna.kmerindex.demo; import io.github.coderodde.dna.kmerindex.DnaKmerIndex; import io.github.coderodde.dna.kmerindex.DnaKmerIndexToStringConverter; import io.github.coderodde.dna.kmerindex.GenomicSequence; import io.github.coderodde.dna.kmerindex.RandomGenomicSequenceProvider; /** * This class provides the demonstration program for the {@code k}-mer index. * * @version 1.0.0 (Aug 16, 2025) * @since 1.0.0 (Aug 16, 2025) */ public final class Demo { private static final int LENGTH = 30; private static final int K = 2; public static void main(String[] args) { long seed = System.currentTimeMillis(); System.out.println("seed = " + seed); String genomicString = RandomGenomicSequenceProvider.generate(LENGTH, seed); System.out.println("Genomic string: " + genomicString); DnaKmerIndex kmerIndex = new DnaKmerIndex(new GenomicSequence(genomicString), K); System.out.println(new DnaKmerIndexToStringConverter(kmerIndex, false)); } } io.github.coderodde.dna.kmerindex.DnaKmerIndexTest.java:
package io.github.coderodde.dna.kmerindex; import java.util.Arrays; import java.util.List; import static org.junit.Assert.*; import org.junit.Test; public class DnaKmerIndexTest { @Test public void getListOfStartingIndices() { GenomicSequence gs = new GenomicSequence("ACGTAC"); DnaKmerIndex index = new DnaKmerIndex(gs, 2); List<Integer> list = index.getListOfStartingIndices(gs.kmer(2, 0)); assertEquals(Arrays.asList(0, 4), list); list = index.getListOfStartingIndices(gs.kmer(2, 1)); assertEquals(Arrays.asList(1), list); list = index.getListOfStartingIndices(gs.kmer(2, 2)); assertEquals(Arrays.asList(2), list); list = index.getListOfStartingIndices(new GenomicSequence("CC")); assertEquals(Arrays.asList(), list); } } io.github.coderodde.dna.kmerindex.GenomicSequenceTest.java:
package io.github.coderodde.dna.kmerindex; import java.util.Random; import static org.junit.Assert.assertEquals; import org.junit.Test; public class GenomicSequenceTest { @Test public void stressTestToString() { Random random = new Random(100L); for (int length = 1; length < 20; ++length) { for (int repeat = 0; repeat < 20; ++repeat) { String sequence = RandomGenomicSequenceProvider.generate(length, random); GenomicSequence gs = new GenomicSequence(sequence); assertEquals(sequence, gs.toString()); } } } @Test public void stressTestKmer() { Random random = new Random(101L); for (int length = 1; length < 20; ++length) { String sequenceString = RandomGenomicSequenceProvider.generate(length, random); GenomicSequence sequence = new GenomicSequence(sequenceString); for (int k = 1; k <= length; ++k) { for (int startIndex = 0; startIndex < length - k + 1; startIndex++) { String kmerString = getKmerString(sequenceString, k, startIndex); GenomicSequence kmerSequence = sequence.kmer(k, startIndex); assertEquals(kmerString, kmerSequence.toString()); } } } } private static String getKmerString(String sequence, int k, int startIndex) { StringBuilder sb = new StringBuilder(k); for (int i = startIndex; i < startIndex + k; ++i) { sb.append(sequence.charAt(i)); } return sb.toString(); } } Typical demo output
seed = 1755516016804 Genomic string: TCGCTTCTCTCCCAACGTCCGGCGGGCAGG CA -> [12, 26] AC -> [14] CC -> [10, 11, 18] GC -> [2, 21, 25] TC -> [0, 5, 7, 9, 17] AG -> [27] CG -> [1, 15, 19, 22] GG -> [20, 23, 24, 28] CT -> [3, 6, 8] GT -> [16] TT -> [4] AA -> [13] Critique request
Please, tell me anything about to improve my tiny library.